• Account
  • Account
    Inquiries
    0

    Inquired items

    0items total Subtotal:$ 0
  • Cart
    Cart

    Inquired items

    items total Subtotal:$ 0

All Departments

RNA interfering

Date: 2015-12-24 Author: Leading Biology Click: 2563

RNA interference (RNAi gene interference, siRNA experiments). RNAi is the post-transcriptional  gene silencing phenomenon, which is caused by double-stranded RNA (DsRNA) homologous to the target gene sequence. Small interfering RNA (siRNA) degrades mRNA of the same sequence and blocks the expression of the corresponding gene. Abiocenter provide SiRNA fragments chemically synthesizing and RNA vector (ShRNA) construction services. Only name or gene ID of target genes are needs for the clients. We will help to screen the intervention sites. At least one pair of effective SiRNA and more than 70% inhibition efficiency are our commitments.


The protocol of siRNA experiment


1. Design and synthesize suitable siRNAs (fragment or vector type) once the target genes were confirmed.

2. Pre-experiment: seed the cells and transfected with the siRNAs, making sure the optimal transfection conditional (time, dose, etc.) for the downstream detection (WB, PCR, etc.) and the inhibition efficiency of every siRNAs sequence.

3. Formal experiment: set up groups and perform transient or stable transfection according to the demands of clients.

4. Perform cytobiological and molecular biological tests, exploring the influences of siRNAs on cells or gene function.


Detection contents

1. Cell detection: cell proliferation, cell apoptosis, cell cycle, cell migration, cell invasion.

2. Protein detection: immunoblotting (WB), immunocytochemistry (ICC), immunofluorescence (IF),      flow cytometry (FCM), enzyme-linked immunosorbent (ELSIA).

3. Molecular biological detection: RT-PCR, real-time fluorescent quantitative PCR, methylation specific PCR (MSP);

4. Other detection: biochemical test, enzyme test, lipid test, sugar test.


Case: Proliferation and invasion ability of YYYY cells after XXXX gene interference


Part I. Cell screening


1. Immunofluorescence

Reagents: PBS (phosphate buffer pH 7.4), non-immune goat serum, Triton X-100, BSA antibody dilution, XXXX protein primary antibody (1:100), secondary antibody Alexa Fluor 555 goat anti-rabbit IgG ( H+L) (A21428)


Staining: remove cell culture medium and rinse three times with PBS. Then, fixed with 2-4% formaldehyde for 15 minutes and wash 3 times each for 5 minutes by 1×PBS buffer (0.01 M, pH 7.4). Further, cover the surface 2-3mm with non-immune goat serum (containing 0.3% Triton X-100) blocking solution, leave it at room temperature for 60min. Next, remove excess liquid and add primary antibody (1:100)150μL, overnight at 4°C. Next day, Wash 3 times with PBS, 5 minutes each. After that, add 50 μL (1:200) of the above-mentioned secondary antibody, and leave it at room temperature for another 60 minutes. Then, wash 3 times with PBS for 5 minutes each. Observe under fluorescent microscope, and choose 2 sets of images for each indicator.


IF staining results (400 times): It can be analyzed by fluorescent staining that the expression of XXXX protein is most prominent in YYYY cells.


YYYY cells


RNAi基因干扰


AAAA cells

RNAi基因干扰


BBBB cells


RNAi基因干扰    

CCCC cells


RNAi基因干扰

2. RT-PCR experiment

Material: 4 cell samples, grouping number (see picture)


Reagents: Trizol Reagent (Invitrogen Cat. NO. 15596-026), ReverTra Ace-α-TM First Strand cDNA Synthesis Kit (TOYOBO #FSK-100), PCR Master Mix(2x) (Fermentas # K0172) DNA Marker (DL2,000, TaKaRa D501A), 0.1% DEPC water, chloroform (analytical grade), isopropanol (analytical grade), 75% ethanol, AGAROSE (AMRESCO, K499), 10×DNA loading buffer (roMab, SJ-R2008523) 5mg/ ml EB solution, 1 × TBE.


Instruments: PCR instrument (ABI9600) electrophoresis instrument (Beijing Liuyi Instrument Company, DYCP-31DN type) high-speed centrifuge (Xiangyi H1650-W), ultraviolet spectrophotometer (Shanghai Jiangyi Instrument Co., Ltd.,), Imaging system (UV-7502C (751)), Kodak UV system 400W pixels.


Primer data:

Homo- XXXX-F 5- cacccatgtctaccaaagtt -3,Homo- XXXX-R 5- ctctcaaaattccagtccag -3, fragment length: 175bp

Homo-GAPDH-F 5-ACCACAGTCCATGCCATCAC-3, Homo-GAPDH-R 5-TCCACCACCCTGTTGCTGTA-3, fragment length 450bp


Experimental protocol:

① RNA extraction: 1ml of Trizol reagent was added to each sample (the tissue was fully shredded 50mg-100mg, the cell number 106-107). Homogenate the sample following with 5-10min standing at room temperature. After that, add 0.2 times volume of chloroform and shaken for 15 seconds. After centrifugation at 12,000 × g for 15 min at 2~8 ° C; transfer the water sample to a clean tube, add 0.5 volume of isopropanol, mix it and let it stand at -20 ° C for 10-15 min at 2 ~ 8 ° C.  Next, centrifuge at 12,000 × g for 10 min, remove the supernatant suspension, wash the RNA pellet with 1 ml of 75% ethanol, mix it on a shaker, centrifuge at 7,500 × g for 5 min at 2-8 °C, discard the supernatant, and moderately dry the RNA. After precipitation, add appropriate amount of 0.1% DEPC water to completely dissolve the RNA. Finally, centrifuge at 2000 rpm for 20 sec.


② Total RNA quantification: warm-up the UV spectrophotometer for 30 min and wash the quartz cuvette with distilled water. Add DEPC water into the dried quartz cuvette, then put it into the S pool rack of the sample room and close the cover. Set the ultraviolet wavelength (260nm, 280nm) and perform zero calibration (zero adjustment before each test). Dilute the samples and record the numbers and dilution condition. (RNA 1μl diluted to 250μl with DEPC water). Placed the samples on the S frame of the sample chamber and close the cover. The OD values at wavelengths of 260 nm and 280 nm are measured respectively (the absorbance is optimal in the range of 0.1-0.5). The quartz cuvette is washed with distilled water and soaked in alcohol.


③ Results analysis: pure DNA: OD260/OD280≈1.8 (>1.9, indicating RNA contamination; <1.6, indicating protein, phenol, etc.) Pure RNA: OD260/OD280≈2.0 (<1.7 indicates protein or Phenol contamination; >2.0 indicates that isothiocyanate may remain)



Sample number


Dilution ratio


A260

A280

A260/A280

RNA concentration(ug/ul)

YYYY

250

0.348

0.179

1.944

3.48

AAAA

250

0.289

0.151

1.914

2.89

BBBB

250

0.302

0.159

1.899

3.02

CCCC

250

0.333

0.171

1.947

3.33


Calculate the A260/A280 ratio, the ratio is ≥1.8, which meets the experimental requirements.


RT-PCR experimental steps: ……


The product was detected by agarose gel electrophoresis: the amplified product was electrophoresed on a 1.5% agarose gel, and the amount of the sample was 10 μl (DNA sample 8 μl + loading buffer 2 μl) at a voltage of 120 V. After electrophoresis, ethidium bromide (EB) was used. The medium was stained for about 15 minutes, and the gel imaging system was photographed after rinsing with water.


Gel image and average optical density values: Positive bands were analyzed by Gel Pro version 4.0 gel densitometry software and their IOD values were measured.



RNAi基因干扰


Sample loading arrangements and IOD reference value analysis:



Lane


1

2

3

4

Sample


YYYY

AAAA

BBBB

CCCC

XXXX gene

15930

8099

10591

12963

R value

0.603

0.325

0.438

0.545

Lane


5

6

7

8

Sample


YYYY

AAAA

BBBB

CCCC

GAPDH

26431

24934

24206

23786


R value is the target gene PLSCR1 reference IOD value / internal reference gene GAPDH reference IOD value

The XXXX gene is most prominently expressed in YYYY cells.


3. WB experiment

Reagents: XXXX protein polyclonal antibody (1:400), GAPDH mAb (1:1000), Rabbit Anti Goat IgG/HRP (1: 30,000), Goat Anti mouse IgG/HRP (1: 50,000)


WB operation process: ……


Results: The positive bands were analyzed by Gel pro version 4.0 gel densitometry software, and the IOD (integrated optical density) cumulative optical density reference value was measured




Lanes:

Lane  1

Lane  2

Lane  3

Lane  4

Rows

(IOD)

(IOD)

(IOD)

(IOD)

XXXX

131.69

51.667

65.03

97.148

GAPDH

283.05

282.52

290.29

289.44

Sample


YYYY

AAAA

BBBB

CCCC


The XXXX protein was expressed most in YYYY cells.


Through the above experiments, it was determined that YYYY cells can be used to perform XXXX gene silencing experiments.




Online Inquiry

Name
Phone *
E-mail Address *
Service & Products Interested *
Project Description
Verification Code * captcha